Journal of Nature and Science (JNSCI), Vol.4, No.4, e500, 2018

Genetics

 

The Role of HSP40 Conserved Motifs in the Response to Cytotoxic Stress

 

Samantha J. Sojourner, Willie M. Graham, Aurellia M. Whitmore, Jana S. Miles, Devon Freeny, and Hernan Flores-Rozas*

 

College of Pharmacy and Pharmaceutical Sciences, Florida A&M University, Tallahassee, FL 32307, USA


Doxorubicin, a highly effective therapeutic agent against several types of cancer, is associated with serious side-effects, particularly cardiotoxicity. In addition, drug resistance leads to unsuccessful outcomes in many patients. There are no current biomarkers to indicate doxorubicin treatment response in patients. To understand the mechanisms of toxicity of doxorubicin, a whole-genome sensitivity screen was performed in the yeast S. cerevisiae. A deletion mutant of the yeast DNAJ (YDJ1), a J-domain heat-shock protein 40 (HSP40) was among the most sensitive strains. HSP40 is a co-chaperone to HSP70 and together refold denatured proteins into native conformation. The HSP40 YDJ1 is comprised of several highly-conserved domains and motifs that are essential in the heat-shock response. The cysteine-rich region has been implicated in protein-protein interaction with client proteins, farnesylation of YDJ1 facilitates attachment of YDJ1 to the ER and perinuclear membranes, and the histidine-proline-aspartic acid (HPD) tripeptide motif present in the J-domain, is responsible for the regulation of the ATPase activity of HSP70s. We have investigated the role of these motifs in the protection cytotoxic stress. We find that mutations in the HPD motif and cysteine-rich region of YDJ1 sensitize cells to doxorubicin and cisplatin, while a mutation in farnesylation results in a slightly protective effect. The sensitivity of the HPD and cysteine mutants is specific to oxidative stress and not to DNA double-strand breaks.

 

Cancer | Doxorubicin | Heat shock proteins | Heat-shock response | Reactive oxygen species

 

Introduction

Doxorubicin is an anthracycline antitumor antibiotic used as first-line treatment, sometimes in conjunction with other chemotherapeutic agents, to treat many types of cancers such as leukemia, lymphoma, soft tissue sarcomas, and multiple myeloma (1). Doxorubicin exerts its anticancer activity through the inhibition of nucleic acid metabolism by intercalation into DNA base pairs and by inhibiting topoisomerase II, thus resulting in the generation of DNA double-strand breaks (DSBs) (2). In addition, doxorubicin increases quinone-type free radical production, which further contributes to cytotoxicity (3). Studies have suggested that free radical-induced DNA damage begins to occur shortly after initiation of doxorubicin treatment (4). The most dangerous side effect of doxorubicin is chronic cardiomyopathy, which can lead to congestive heart failure (5). While the iron-chelating drug dexrazoxane has been used to mitigate doxorubicin*s cardiotoxicity by reducing the load of reactive oxygen species in cardiomyocytes (6), it has been associated with the development of secondary cancers including acute myeloid leukemia and myelodysplastic syndrome (7). In addition to severe side effects, the development of drug resistance compromises the efficacy of doxorubicin-based regimens (8).

In an attempt to better understand the underlying mechanisms involved in the sensitivity to doxorubicin, a whole-genome sensitivity screen of the yeast Saccharomyces cerevisiae was performed by Ling Xia and colleagues (9). The study characterized several genes and pathways that contribute to protection of the cell from exposure to doxorubicin, including the heat shock response. The ydj1- knockout strain was found to be highly sensitive to heat shock and cisplatin exposure in addition to doxorubicin.

YDJ1 encodes for a yeast heat shock protein 40 (HSP40), and is a homolog of the E. coli chaperone protein DNAJ. DNAJ, an HSP40, is a crucial factor in the heat shock response (10), the cellular response to certain types of stress such as elevated temperatures, infection, inflammation and starvation. The accumulation of misfolded proteins during certain cellular stresses induces the heat shock response. The response is mediated by genes encoding for heat shock proteins that are up-regulated through transcription (11). Heat shock proteins have essential roles in the folding, unfolding, translocation, and degradation of proteins (12). DNAJs/HSP40s are considered chaperones as they have the ability to bind to exposed hydrophobic residues of both unfolded and nascent polypeptides (13). However, DNAJs/HSP40s are mostly considered to be co-chaperones of DNAKs/HSP70s (14,15). HSP70 functions to refold misfolded polypeptides, but is a weak ATPase and therefore requires stimulation of ATP hydrolysis through its interaction with HSP40.

The Ydj1p protein is comprised of several highly-conserved domains/motifs that are essential for its function. The HPD tripeptide motif of the N-terminal J-domain has been demonstrated to regulate the ATPase activity of HSP70s (16每19).  The centrally-located cysteine-rich region of YDJ1 has been implicated in protein-protein interaction. Ydj1p is also post-translationally modified by farnesylation which enhances its affinity for the ER and perinuclear membranes of the cell. In this work, we characterize the role of the mentioned motifs of YDJ1 in response to cytotoxic stress.  We find that the HPD motif and the cysteine-rich regions are essential for the response to doxorubicin, cisplatin and as previously demonstrated, to heat-shock. The sensitivity of HPD and cysteine mutant strains is, in part, due to doxorubicin-induced oxidative stress and not to the generation of DSBs.

 

Materials and Methods

 

Media and chemicals

E. coli strains were grown in LB broth or on LB agar, both supplemented with 100 µg/ml ampicillin (Sigma Aldrich) for plasmid maintenance, when appropriate. Yeast strains were grown in either yeast/peptone/dextrose (YPD) media (1% yeast extract, 2% peptone, 2% dextrose, 2% agar) or Leu- selective media containing 0.67% yeast nitrogen base, 2% agar, 2% glucose (dextrose) or 2% galactose, and 0.087% of a drop-out mix that lacks the amino acid leucine for selection (20,21). When required, etoposide (Chem-Impex Int*l. Inc.) was included in Leu- selective media at 1 mM concentration.

Doxorubicin-HCl (2 mg/mL) was purchased from Bedford Laboratories (Eatontown, NJ, USA); cisplatin (1 mg/mL) was purchased from Calbiochem; menadione (Vitamin K3) was purchased from Enzo Life Sciences (Farmingdale, NY); etoposide was purchased from Chem-Impex Int*l. Inc (Wood Dale, IL).

 

Nucleic Acid Techniques

Point mutations in each of the motifs studied were introduced into the coding sequence of the YDJ1 gene cloned in the pBlueScript vector by site-directed mutagenesis. Two overlapping complementary oligonucleotides targeting each motif mutation were synthesized to contain the corresponding nucleotide change(s). Primers were around 50-nucleotides in length. Each primer pair was annealed to the pBlueScript-YDJ1 clone followed by PCR amplification. After PCR the non-mutated template pBlueScript-YDJ1 plasmid was eliminated by digestion with DpnI. The reaction mixture was transformed into NEB 5-alpha (New England BioLabs. Ipswich, MA) high efficiency competent cells and colonies were selected on LB-ampicillin plates. Single colonies were isolated, plasmid DNA construct was purified and the mutations introduced into the coding sequences of the YDJ1 motifs were confirmed by DNA sequencing (22). The
oligonucleotide primers used for the site-directed mutagenesis are listed in Table 1. The sequence-confirmed pBluescript-YDJ1 mutant constructs were restricted with SacI and EcoRI and the mutant YDJ1 DNA-containing insert was cloned into the pYX243 plasmid vector. Correct constructs were then restricted with SacI and EcoRI to confirm the presence of the mutant YDJ1 DNA insert.

 

Yeast Genetics

ydj1- strain was grown overnight in YPD media (1% yeast extract, 2% peptone, 2% glucose, 2% agar) at 30∼C with shaking, then transformed with pXY243 plasmids harboring mutant YDJ1 using a yeast transformation kit (Frozen EZ Yeast Transformation II, Zymo Research). Transformed cells were selected by plating on Leucine dropout (Leu-) agar glucose plates and grown at 30∼C for 2-4 days. Single colonies were picked and glycerol (15% v/v) stocks were stored at -80∼C for further analysis (23).

 

S. cerevisiae strains

The genotypes of all strains used in these studies are shown in Table 2. Homozygous haploid deletion strains library (Parental strain BY4741: MATa his3忖1 leu2忖0 met15忖0 ura3忖0) was obtained from Thermo Fisher Scientific (Pittsburgh, PA). Wildtype YDJ1 or mutant YDJ1-expressing pYX243 plasmids were transformed into the ydj1- deletion strain. The rad52- (homologous recombination deficient)and sod1- (superoxide dismutase deficient) deletion strains, used as controls, were also transformed with pYX243 (2µ, LEU2, Gal-promoter) for appropriate selection.


 

Table 1: Oligonucleotide Primer Sequences for Site-directed mutagenesis.

Name

Oligonucleotide Set Sequence

Location

Mutation

(Amino Acid)

HFR3001

 

HFR3002

5* TATAGAAAATGCGCCTTAAAATACCAACCAGATAAGAATCCAAGTGAG 3*(FWD)

 

5* CTCACTTGGATTCTTATCTGGTTGGTATTTTAAGGCGCATTTTCTATA 3*(REV)

 HPD motif

T102A

(His to Glu)

HFR3003

 

HFR3004

5* GGTAAGAAAGGCGCCGTCAAGAAGACTACCAGCTGTAATGGTCAAGGTATT 3*(FWD)

 

5* AATACCTTGACCATTACAGCTGGTAGTCTTCTTGACGGCGCCTTTCTTACC 3*(REV)

 Cysteine

repeats

T475A

G476C

(Cys to Thr)

HFR3009

 

HFR3010

5* GATGAAGAAGAACAAGGTGGCGAAGGTGTTCAAAGTGCATCTCAATGA 3* (FWD)

 

5* TCATTGAGATGCACTTTGAACACCTTCGCCACCTTGTTCTTCTTCATC 3* (REV)

 Farnesylation

site

T1216A

(Cys to Ser)

 

Table 2: Yeast strains used in this study.

Name

Strain

Genotype

ydj1-

ydj1-

MATa his3-1 leu2D met15D ura3D ydj1D [pYX243 LEU2]

YDJ1

YDJ1

MATa his3-1 leu2D met15D ura3D ydj1D [pYX243-YDJ1 LEU2]

HPD

ydj1-H34E

MATa his3-1 leu2D met15D ura3D ydj1D [pYX243-ydj1-H34E LEU2]

cys

ydj1-C159T

MATa his3-1 leu2D met15D ura3D ydj1D [pYX243-ydj1-C159T LEU2]

far

ydj1-C406S

MATa his3-1 leu2D met15D ura3D ydj1D [pYX243-ydj1-C406S LEU2]

rad52-

rad52-

MATa his3-1 leu2D met15D ura3D rad52D [pYX243 LEU2]

sod1-

sod1-

MATa his3-1 leu2D met15D ura3D sod1D [pYX243 LEU2]

 

Table 3: Sensitivity of YDJ1 strains to cytotoxic stressors.

 

 

Strain

Heat Shock

Doxorubicin

Cisplatin

Survival

(% SEM)

Sensitivity

(fold)

Survival

(% SEM)

Sensitivity (fold)

Survival

(% SEM)

Sensitivity (fold)

ydj1-

0 ㊣ 0.0

---

2 ㊣ 1.3

34.0

1 ㊣ 0.1

86.0

YDJ1

91 ㊣ 11.1

1

68 ㊣ 4.3

1.0

86 ㊣ 21.0

1.0

HPD

2 ㊣ 2.1

45.5

8 ㊣ 3.8

8.5

7 ㊣ 3.0

12.3

cys

2 ㊣ 1.6

45.5

3 ㊣ 1.0

22.7

2 ㊣ 0.5

43.0

far

85 ㊣ 8.6

1.1

81 ㊣ 3.8

0.8

115 ㊣ 8.1

0.7

rad52-

 

 

 

 

3 ㊣ 0.8

28.7

 

 


Cytotoxic stress sensitivity assays

The concentrations of drug and lengths of exposure to heat shock (37∼C), doxorubicin, cisplatin, menadione and etoposide were previously determined experimentally using the wild type parental strain, BY4741, as well as the mutants ydj1- strain. Colonies of each strain containing a YDJ1 mutation were selected on Leu- agar, glucose plates and grown overnight (~20 hours) in Leu-, galactose (2%), glucose (0.5%) liquid medium at 30∼C with shaking. Following overnight culturing, cells were washed and re-suspended in sterile water. Cells suspensions were separated into control (no drug, or 30∼C for heat shock test) and test groups, where cells were treated by exposure to various chemical agents for a period of 30 minutes (for doxorubicin), or 3 hours (cisplatin and menadione). After the period of exposure, cells were once again washed and suspended in sterile water. Serial dilutions were performed on 96-well plates, and 10 µl of cells from each dilution was spotted onto Leu- agar, galactose plates. Plates were incubated at 30∼C (heat shock treated cells were incubated at 37∼C) for a period of 72 hours. Cells treated with etoposide were washed, serially diluted, and spotted directly onto Leu-, galactose, etoposide plates to grow for 72 hours at 30∼C. Cell growth was monitored daily, and strain sensitivity was scored after 72 hours by calculating survival using the ydj1- +pYX243[YDJ1] strain as the control. Sensitivity was calculated relative to untreated controls. Data was collected from at least 3 trials for each YDJ1 mutant and for each stressor. Survival percentages were calculated by dividing the number of colonies present on treated plates by the number of colonies present on non-treated plates for each strain.

 

Statistical Analysis

Data analysis and graphing was performed using Graph Pad Prism 6 software. Specific analysis for each experiment is indicated in each figure legend. The mean of at least three experiments is plotted together with the standard error of the mean. Significance was determined using One-way ANOVA.

 

Results

 

Differential sensitivity of YDJ1 mutants to Heat Shock, Doxorubicin and Cisplatin

All pYX243-based constructs were generated and confirmed as described in the Materials and Methods. The mutations introduced in the YDJ1 gene are described in Table 1. Plasmids harboring these gene alleles were transformed into the ydj1- strain as described in the Materials and Methods. The strains generated and used for this study are described in Table 2. To observe the sensitivity of YDJ1 mutant strains to cytotoxic stress, strains were exposed to heat shock, doxorubicin, and cisplatin as described in the Materials and Methods. Figure 1 displays results from exposure of YDJ1 strains to heat shock. As observed in Figure 1A, the ydj1- deletion strain, which was included as a positive control for sensitivity, does not survive after exposure to heat shock as previously described. The strain expressing wild type YDJ1 (Fig. 1A, YDJ1), survives heat shock treatment, with a 91% survival. Analysis of the strains harboring YDJ1 mutant alleles indicates that the cysteine and HPD mutant strains displayed sensitivity comparable to that of the ydj1- strain (2%, 2% and 0%, respectively), while the farnesylation mutant strain displayed survival (85%) comparable to the strain complemented with the wild type YDJ1 strain. Quantitative analysis is displayed in the Fig. 1B, which illustrates the mean survival (in percentage) in response to heat shock (N=3) of the YDJ1 strains relative to the untreated control (Fig 1A). The data indicate that cys and HPD mutants displayed a 45-fold increased sensitivity (p<0.05) to heat-shock relative to the YDJ1-complemented strain (Table 3).

 

Figure 1. Sensitivity of YDJ1 mutants to heat shock.  A. Growth of YDJ1 mutants in response to heat shock. Strains growth tested by spotting onto Leu- agar, galactose plates. B. Survival rates of strains following heat shock. Survival was compared to the YDJ1-complemented strain. * indicates p-values less than 0.05 which relate to strong presumption of statistical significance.

 

The YDJ1 strains were tested for sensitivity to doxorubicin exposure (Fig 2A). The ydj1- deletion strain is notably sensitive, as growth is significantly repressed (2% survival) compared to the complemented YDJ1 strain (68% survival), at the concentration of doxorubicin tested. The cyst and HPD mutant strains also displayed repressed growth similar to the ydj1- strain (3% and 8% survival, respectively). Inversely, farnesylation mutant strain was resistant to doxorubicin exposure, displaying slightly more resistance than YDJ1 (81% vs 68% survival). Figure 2B illustrates the mean survival percentage of the YDJ1 strains following doxorubicin exposure (N=3). Table 3 displays the fold sensitivity of each strain compared to the positive control strain (YJD1). The cysteine mutant displayed a ~23-fold increased sensitivity, while the HPD mutant displayed an 8-fold increased sensitivity to doxorubicin relative to the YDJ1-complemented strain (Table 3). The differences in response of the ydj1- deletion, cysteine, and HPD mutants to doxorubicin compared to the positive control are statistically significant (p<0.05), while there is not much difference between the survival of the farnesylation mutant and the positive control YDJ1.

 

Figure 2. Sensitivity of YDJ1 mutants to doxorubicin. A. Growth of YDJ1 mutants in response to doxorubicin exposure. Strains growth tested by spotting onto Leu- agar, galactose plates. B. Survival rates of strains following doxorubicin exposure. Survival of mutant alleles was compared to the YDJ1-complemented strain. * indicates p-values less than 0.05 which relate to strong presumption of statistical significance.

 

Responses of the YDJ1 strains to cisplatin exposure are shown below (Fig. 3). The positive control used in cisplatin sensitivity assays was rad52-, a deletion strain deficient in the gene encoding RAD52, which is involved in DNA double-strand break repair by homologous recombination. Because cisplatin causes DNA cross-linking, it is expected that cells lacking the ability to repair DNA damage would be sensitive to cisplatin exposure. The YDJ1 strains displayed similar responses to doxorubicin exposure. The ydj1- and rad52- strains were sensitive to cisplatin as expected (1% and 3% survival, respectively). Similarly, the cysteine and HPD strains also displayed high sensitivity to cisplatin (2% and 7% survival, respectively). The YDJ1 and farnesylation strains showed almost no inhibition of growth at the concentration of cisplatin tested. Figure 3B illustrates the mean of the survival (in percentage) of the strains following exposure to cisplatin (N=3). Table 3 displays the fold sensitivity of each strain compared to the positive control strain (YJD1).  The sensitivity to cisplatin varied depending on the mutant, with the cysteine mutant being 43-fold and the HPD ~12-fold more sensitive than the YDJ1-complemented strain. By comparison, the ydj1- strain was 86-fold more sensitive than the YDJ1-complemented strain (Fig 3B and Table 3).

 

Figure 3. Sensitivity of YDJ1 mutants to cisplatin.  A. Growth of YDJ1 mutants in response to cisplatin treatment. Colony growth of strains spotted onto Leu- agar galactose plates. B. Survival rates of strains following cisplatin exposure. * indicates p-values less than 0.05 which relate to strong presumption of statistical significance.

 

Sensitivity of YDJ1 mutants to etoposide and menadione

To identify the specific toxic mechanism to which the YDJ1-mutants strains are sensitive to doxorubicin, they were exposed to etoposide, which generates DSBs and menadione, which generates reactive oxygen species (ROS).

Sensitivity of YDJ1 strains to etoposide are shown below (Fig. 4). The rad52- deletion strain was also used as a positive (sensitive) control for etoposide treatment. Etoposide inhibits topoisomerase II in same manner as doxorubicin, resulting in DNA double strand breaks, however, it does not generate ROS. It would be expected that cells deficient in the RAD52 would be sensitive to etoposide, as RAD52 is an important protein for DNA double-strand break repair. In fact, the rad52- displayed a 20-fold increased sensitivity (5% survival) to etoposide relative to the YDJ1-complemented strain (Fig 4B and Table 4). However, the YDJ1 mutant strains did not display sensitivity to etoposide exposure. The ydj1- mutant strain along with the cysteine, HPD, and farnesylation strains displayed survival similar to the complemented YDJ1 strain. Figure 4B illustrates the mean survival percentages of the YDJ1 strains following exposure to etoposide (N=3). Table 4 displays the fold sensitivity of each strain compared to the wild type YDJ1-complemented strain (YJD1). Only the positive control rad52- was sensitive to etoposide (5% survival).

 

Figure 4. Sensitivity of YDJ1 mutants to etoposide. A. Growth of YDJ1 mutants in response to etoposide. Growth of different YDJ1-alleles strains was tested by spotting onto Leu- agar galactose plates. B. Survival rates of strains following etoposide treatment in percentage. * indicates p-values less than 0.05 which relate to strong presumption of statistical significance.

 

Sensitivity of YDJ1 strains to menadione is shown below (Fig. 5). The sod1- deletion strain was used as the positive control for sensitivity to menadione treatment. Menadione features the same quinone ring present in the doxorubicin structure, both of which produce quinone-type free radicals including superoxide. SOD1 is a superoxide dismutase that destroys free superoxide radicals. Without SOD1, it is expected that the cell would not be able to protect itself from agents that produce superoxide. The response of the strains was similar to that observed for doxorubicin and cisplatin responses. While sod1- was sensitive to menadione exposure (no growth, Fig 5A and 5B), as expected, ydj1- deletion strain, cysteine mutant, and HPD mutant were also sensitive to menadione (1%, 3% and 11% survival, respectively). YDJ1 and farnesylation were resistant (85% survival). Figure 5B illustrates the mean survival percentages of the YDJ1 strains following exposure to etoposide (N=3). Table 4 displays the fold sensitivity of each strain compared to the wild type YDJ1-complemented strain (YJD1). The ydj1- and the cys mutants displayed significant sensitivity (57- and 19-fold, respectively. p<0.05), while the HPD mutant was ~5-fold more sensitive than the YDJ1-complemented strain.

 

Table 4: Sensitivity of YDJ1 strains to etoposide and menadione

 

 

Strain

Etoposide

Menadione

Survival

(% SEM)

Sensitivity

(fold)

Survival

(% SEM)

Sensitivity

(fold)

ydj1-

87 ㊣ 5.4

1.2

1 ㊣ 0.8

57

YDJ1

102 ㊣ 4.4

1

57 ㊣ 1.8

1

HPD

99 ㊣ 18.0

1

11 ㊣ 4.6

5.18

 

cys

 

103 ㊣ 3.1

1

3 ㊣ 1.1

19

far

99 ㊣ 18.0

1

85 ㊣ 9.6

0.7

rad52-

5 ㊣ 4.8

20.4

 

 

sod1-

 

 

0 ㊣ 0.0

---

 

Figure 5. Sensitivity of YDJ1 mutants to menadione. A. Growth of YDJ1 mutants in response to menadione exposure. Colony growth of strains spotted onto Leu- agar galactose plates. B. Survival rates of strains following menadione treatment. * indicates p-values less than 0.05 which relate to strong presumption of statistical significance.

 

Discussion

Each of the targeted motifs has been previously mentioned to be essential for the function of YDJ1 in the heat shock response. The importance of these motifs has not been previously evaluated in response to chemotherapeutic drugs exposure. Strains with mutations in each of the targeted motifs were created through point mutations introduced into the YDJ1 gene by site-directed mutagenesis and cloned into the inducible expression plasmid pYX243, followed by transformation into ydj1- strains. Resulting strains had disruptions in either the HPD tripeptide motif, cysteine-rich region, farnesylation sites of the YDJ1 protein. Mutations in some of these motifs altered the function of YDJ1 in response to cytotoxic stress.

Identifying motifs of YDJ1 that are essential for cellular protection against cytotoxic stress may result in the identification of new targets for mitigating drug resistance and negative effects of doxorubicin treatment.

We determined that mutations in the HPD motif and cysteine-rich region of YDJ1 resulted in strains with a sensitive phenotype that could not survive upon exposure to heat shock, doxorubicin, and cisplatin. These findings imply that a correctly functioning HPD motif and cysteine-rich region are necessary for proper function of YDJ1 during the response to cytotoxic stressors. The HPD and cys mutant strains were several-fold more sensitive to the above-mentioned treatments compared to YDJ1, which served as the positive control, as the wild type YDJ1 gene without any mutations was transformed into this strain.

The J-domain of YDJ1 harboring the HPD motif is believed to be the major site of interaction with HSP70. The ATP-binding form of HSP70 has a low affinity for unfolded peptides. In the presence of HSP40, however, ATP hydrolysis is enhanced. This leads to enhanced HSP70 activity. Mutations in the HPD motif have been shown to eliminate stimulation of HSP70 ATPase activity (24).

YDJ1 contains a conserved zinc finger-like region that includes 4 repeats of the CXXCXGXG motif, where C is cysteine and G is glycine. The repeats function in pairs to form a zinc-binding domain, which are implicated in protein-protein interactions (25,26). Mutations in the zinc finger-like region have been shown to reduce the activity of type 1 HSP40s (27,28). Fan et al. found that mutations in the zinc finger-like region of YDJ1 resulted in defects in androgen receptor function and luciferase refolding. They found that the zinc finger-like region of type 1 HSP40s is required for HSP70 capture of non-native polypeptides from YDJ1 (29).

While the responses of the HPD and cys mutant strains were consistent with findings in the literature and their essential role in the heat shock response, the farnesylation site mutant strain was not observed to be sensitive to any of the stressors used in this study. In fact, mutation of the farnesylation site of YDJ1 caused the strain to become more resistant than the positive control YDJ1 strain after exposure to doxorubicin and cisplatin. The farnesylation mutant strain had survival rates similar to the YDJ1 control strain in response to heat shock and etoposide.

Type 1 HSP40s contain a unique CAAX box at the C-terminal of the protein which becomes post-translationally modified with a farnesyl group (30,31). Farnesylation of type 1 HSP40s aids in localizing the protein to the ER membrane, where they function to fold polytopic membrane proteins. Since all YDJ1 proteins are farnesylated, but many are found in the cytosol, it is thought that farnesylation may have additional roles. Although the significance of YDJ1 farnesylation in the heat shock response has not been extensively studied, it has been shown to be essential for YDJ1 protection against prion toxicity (32).

The absence of sensitivity of farnesylation mutant strains to cytotoxic stressors is logical if farnesylation of YDJ1 is not necessary for proper function in the heat shock response. However, it is not known why a mutation in the farnesylation site of YDJ1 leads to an increase in resistance to cytotoxic stress. One theory is that the loss of YDJ1 farnesylation results in loss of ER membrane sequestration of the protein, allowing for increased overall interaction with HSP70 and client proteins in the cytoplasm.

The response of all strains to doxorubicin and cisplatin was almost identical, suggesting that the studied YDJ1 motifs may be necessary for cell survival in response to diverse cytotoxic agents. In addition, strains responded similarly to heat shock exposure as to doxorubicin and cisplatin, suggesting that the mechanism of protection by HSP40 against cytotoxic agents is similar to that of heat shock.

Etoposide and menadione were included in this study to elucidate the cytotoxic mechanism of doxorubicin in the role of a gene encoding a factor involved in protein folding. Doxorubicin is known to exerts toxic effects through poisoning of topoisomerase II leading to DSBs and the formation of ROS through its quinone ring. Etoposide acts through topoisomerase II inhibition like doxorubicin, and menadione contains the same quinone ring as doxorubicin and can produce quinone-type free radicals. It was observed that YDJ1 mutant strains responded similarly to menadione as to doxorubicin and cisplatin; the HPD and cys mutants were sensitive, and the YDJ1 control and farnesylation mutant, resistant. However, none of the YDJ1 mutant strains were sensitive to etoposide, only the positive control rad52 deletion strain was sensitive. These results suggest that the production of ROS, such as superoxide, may the cause of protein damage in the cell. While DNA double-strand breaks affects the cell on the DNA level, these damages do not require a functional YDJ1. In contrast, proteins can be damaged by reactive oxygen species through direct oxidation of amino acid residues and cofactors (33). Cisplatin can also bind to protein, and possibly affect their structure by forming adducts, explaining the requirement for protein chaperones in cell survival. In addition, cisplatin has the potential of forming DNA-protein crosslinks (34).

Yeast strains containing mutations in the conserved HPD motif and cysteine-rich region of YDJ1 display distinct sensitivity when exposed to chemotherapeutic agents as well as heat shock, suggesting that they play essential roles in protection of the cell from cytotoxic stress. Targeting these regions of the YDJ1 protein may provide a useful method of sensitizing cancer cells to chemotherapy, lowering the effective therapeutic dose and concomitantly resulting in reduction of side effects. 

 

Acknowledgements

We are grateful for the support provided by the Gene and Cell Manipulation Facility of Florida A&M University. This project was supported by the National Center for Research Resources and the National Institute of Minority Health and Health Disparities of the National Institutes of Health through Grant Number P20MD006738 and G12MD007582.



1.   Martindale: The Complete Drug Reference. Brayfield Alison (Ed). Pharmaceutical Press; 39th Revised edition (June 16, 2017).  ISBN-13: 978-0857113092.

2.   Tacar O, Sriamornsak P, Dass CR. Doxorubicin: An update on anticancer molecular action, toxicity and novel drug delivery systems. Journal of Pharmacy and Pharmacology. 2013. 65(2):157每70.

3.   Minotti G, Recalcati S, Menna P, Salvatorelli E, Corna G, Cairo G. Doxorubicin cardiotoxicity and the control of iron metabolism: quinone-dependent and independent mechanisms. Methods Enzymol. 2004. 378:340-61.

4.   L*Ecuyer T, Sanjeev S, Thomas R, Novak R, Das L, Campbell W, Heide RV. DNA damage is an early event in doxorubicin-induced cardiac myocyte death. Am J Physiol Heart Circ Physiol. 2006. 291(3):H1273每80.

5.   Lenneman AJ, Wang L, Wigger M, Frangoul H, Harrell FE, Silverstein C, Sawyer DB, Lenneman CG. Heart transplant survival outcomes for adriamycin-dilated cardiomyopathy. Am J Cardiol. 2013. 111(4):609-12.

6.   Chatterjee K, Zhang J, Honbo N, Karliner JS. Doxorubicin cardiomyopathy. Cardiology. 2010. 115(2):155每62.

7.   Vrooman LM1, Neuberg DS, Stevenson KE, Asselin BL, Athale UH, Clavell L, Cole PD, Kelly KM, Larsen EC, Laverdi豕re C, Michon B, Schorin M, Schwartz CL, Cohen HJ, Lipshultz SE, Silverman LB, Sallan SE. The low incidence of secondary acute myelogenous leukaemia in children and adolescents treated with dexrazoxane for acute lymphoblastic leukaemia: a report from the Dana-Farber Cancer Institute ALL Consortium. Eur J Cancer. 2011. 47(9):1373-9.

8.   Huang RY, Kowalski D, Minderman H, Gandhi N, Johnson ES. Small ubiquitin-related modifier pathway is a major determinant of doxorubicin cytotoxicity in Saccharomyces cerevisiae. Cancer Res. 2007. 67(2):765每72.

9.   Xia L, Jaafar L, Cashikar A, Flores-Rozas H. Identification of genes required for protection from doxorubicin by a genome-wide screen in Saccharomyces cerevisiae. Cancer Res. 2007. 67(23):11411每8.

10.   Richter K, Haslbeck M, Buchner J. The Heat Shock Response: Life on the Verge of Death. Molecular Cell. 2010. 40:253每66.

11.   Pockley AG. Heat shock proteins as regulators of the immune response. Lancet. 2003. 362(9382):469每76.

12.   Patricia Hern芍ndez M, Chadli A, Toft DO. HSP40 binding is the first step in the HSP90 chaperoning pathway for the progesterone receptor. J Biol Chem. 2002. 277(14):11873每81.

13.   Szabo A, Korszun R, Hartl FU, Flanagan J. A zinc finger-like domain of the molecular chaperone DnaJ is involved in binding to denatured protein substrates. EMBO J [Internet]. 1996. 15(2):408每17.

14.   Johnson JL, Craig EA. An essential role for the substrate-binding region of Hsp40s in Saccharomyces cerevisiae. J Cell Biol. 2001. 152(4):851每6.

15.   Michels AA, Kanon B, Konings AWT, Ohtsuka K, Bensaude O, Kampinga HH. Hsp70 and Hsp40 chaperone activities in the cytoplasm and the nucleus of mammalian cells. J Biol Chem. 1997. 272(52):33283每9.

16.   Wall D, Zylicz M, Georgopoulos C. The NH2-terminal 108 amino acids of the Escherichia coli DnaJ protein stimulate the ATPase activity of DnaK and are sufficient for 竹 replication. J Biol Chem. 1994. 269(7):5446每51.

17.   Mayer MP, Laufen T, Paal K, McCarty JS, Bukau B. Investigation of the interaction between DnaK and DnaJ by surface plasmon resonance spectroscopy. J Mol Biol. 1999. 289(4):1131每44.

18.   Kelley WL, Georgopoulos C. The T/t common exon of simian virus 40, JC, and BK polyomavirus T antigens can functionally replace the J-domain of the Escherichia coli DnaJ molecular chaperone. Proc Natl Acad Sci U S A. 1997. 94(8):3679每84.

19.   Tsai J, Douglas MG. A conserved HPD sequence of the J-domain is necessary for YDJ1 stimulation of Hsp70 ATPase activity at a site distinct from substrate binding. J Biol Chem. 1996. 271(16):9347每54.

20.   Kolodner RD, Alani E. Mismatch repair and cancer susceptibility. Curr Opin Biotechnol. 1994. 5(6):585每94.

21.   Tishkoff DX, Boerger AL, Bertrand P, Filosi N, Gaida GM, Kane MF, et al. Identification and characterization of Saccharomyces cerevisiae EXO1, a gene encoding an exonuclease that interacts with MSH2. Proc Natl Acad Sci U S A. 1997. 94(14):7487每92.

22.   Flores-Rozas H, Clark D, Kolodner RD. Proliferating cell nuclear antigen and Msh2p-Msh6p interact to form an active mispair recognition complex. Nat Genet. 2000. 26(3):375每8.

23.   Amberg DC, Burke D, Strathern JN, Burke D, Cold Spring Harbor Laboratory. Methods in yeast genetics : a Cold Spring Harbor Laboratory course manual. Cold Spring Harbor Laboratory Press; 2005. ISBN-13: 978-0879697280

24.   Cheetham ME, Caplan AJ. Structure, function and evolution of DnaJ: Conservation and adaptation of chaperone function. Cell Stress and Chaperones. 1998. 3(1):28每36.

25.   Li J, Qian X, Sha B. The Crystal Structure of the Yeast Hsp40 Ydj1 Complexed with Its Peptide Substrate. Structure. 2003. 11(12):1475每83.

26.   Martinez-Yamout M, Legge GB, Zhang O, Wright PE, Dyson HJ. Solution structure of the cysteine-rich domain of the Escherichia coli chaperone protein DnaJ. J Mol Biol. 2000. 300(4):805每18.

27.   Banecki B, Liberek K, Wall D, Wawrzynow A, Georgopoulos C, Bertoli E, et al. Structure-function analysis of the zinc finger region of the DnaJ molecular chaperone. J Biol Chem. 1996. 271(25):14840每8.

28.   Linke K, Wolfram T, Bussemer J, Jakob U. The Roles of the Two Zinc Binding Sites in DnaJ. J Biol Chem. 2003. 278(45):44457每66.

29.   Fan CY, Ren HY, Lee P, Caplan AJ, Cyr DM. The type I Hsp40 zinc finger-like region is required for Hsp70 to capture non-native polypeptides from Ydj. J Biol Chem. 2005. 280(1):695每702.

30.   Caplan AJ, Douglas MG. Characterization of YDJ1: A yeast homologue of the bacterial dnaJ protein. J Cell Biol. 1991. 114(4):609每21.

31.   Meacham GC. The Hdj-2/Hsc70 chaperone pair facilitates early steps in CFTR biogenesis. EMBO J. 1999. 18(6):1492每505.

32.   Summers DW, Douglas PM, Ren HY, Cyr DM. The type I Hsp40 Ydj1 utilizes a farnesyl moiety and zinc finger-like region to suppress prion toxicity. J Biol Chem. 2009. 284(6):3628每39.

33.   Costa V, Quintanilha A, Moradas-Ferreira P. Protein oxidation, repair mechanisms and proteolysis in Saccharomyces cerevisiae. IUBMB Life. 2007. 59(4):293每8.

34.   Groehler A, Degner A, Tretyakova NY. Mass Spectrometry-Based Tools to Characterize DNA每Protein Cross-Linking by Bis-Electrophiles. Basic and Clinical Pharmacology and Toxicology. 2017. Suppl 3:63每77.



Conflict of Interest: No conflicts declared.

* Corresponding Author. Hernan Flores-Rozas, Ph.D.

College of Pharmacy and Pharmaceutical Sciences,

Florida A&M University, 1415 S. Martin Luther King Blvd,

Tallahassee, Florida 32307, USA. Phone: 850-412-7088

Email: hernan.floresrozas@famu.edu

© 2018 by the Authors | Journal of Nature and Science (JNSCI).